In a new study in Cell Discovery, Chen-Yu Zhang’s group at Nanjing University and two other groups from Wuhan Institute of Virology and the Second Hospital of Nanjing present a novel finding that absorbed miRNA MIR2911 in honeysuckle decoction (HD) can directly target SARS-CoV-2 genes and inhibit viral replication. Drinking of HD accelerate the negative conversion of COVID-19 patients.

#mir2911 #sarcov2 #honeysuckle

Zhou, L., Zhou, Z., Jiang, X. et al. Absorbed plant MIR2911 in honeysuckle decoction inhibits SARS-CoV-2 replication and accelerates the negative conversion of infected patients. Cell Discov 6, 54 (2020). https://doi.org/10.1038/s41421-020-00197-3

https://www.nature.com/articles/s41421-020-00197-3#ethics

Categories: Misc....

Tags: Alchepharma, citation, coronavirus, covid19, credible, current, Data, docking site, endpoint, Gene, GGCCGGGGGACGGACUGGGA, H1N1, H5N1, H7N9, HD, Health, Honeysuckle, Honeysuckle decoction, influenza A, inhibit replication, inhibits the replication, medical, MIR2911, miRNA, new, peer reviewed, published, Ralph Turchiano, Research, SARS-CoV-2, sarscov2, science, study